ID: 1106409508_1106409518

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1106409508 1106409518
Species Human (GRCh38) Human (GRCh38)
Location 13:29501431-29501453 13:29501475-29501497
Sequence CCTCCTGCAGCACTGGGAGGGGA ATTAGGAGAGGAGGGCCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 519} {0: 1, 1: 0, 2: 1, 3: 19, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!