ID: 1106415258_1106415265

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1106415258 1106415265
Species Human (GRCh38) Human (GRCh38)
Location 13:29540954-29540976 13:29541007-29541029
Sequence CCTCATGGCTGGCATGTGGGCAG GAGTGTGCACAGAAGGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 297} {0: 1, 1: 0, 2: 4, 3: 37, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!