ID: 1106421478_1106421488

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1106421478 1106421488
Species Human (GRCh38) Human (GRCh38)
Location 13:29589526-29589548 13:29589545-29589567
Sequence CCCAGGGCTCCAGCTGTGCCAGG CAGGTGCCTGGACTTGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 53, 4: 513} {0: 1, 1: 0, 2: 4, 3: 55, 4: 451}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!