ID: 1106477004_1106477008

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1106477004 1106477008
Species Human (GRCh38) Human (GRCh38)
Location 13:30107663-30107685 13:30107684-30107706
Sequence CCTGGATGTGTCAGACCATGAGC GCCTTGGCAGTGGAGAAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101} {0: 1, 1: 0, 2: 5, 3: 42, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!