ID: 1106544515_1106544524

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1106544515 1106544524
Species Human (GRCh38) Human (GRCh38)
Location 13:30718479-30718501 13:30718514-30718536
Sequence CCTTGCCCCCTTCCTCCATCCTT TACCCATCCACTGTGCCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 22, 3: 305, 4: 3387} {0: 1, 1: 0, 2: 0, 3: 19, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!