ID: 1106544521_1106544524

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1106544521 1106544524
Species Human (GRCh38) Human (GRCh38)
Location 13:30718494-30718516 13:30718514-30718536
Sequence CCATCCTTTTCTCCATTGCATAC TACCCATCCACTGTGCCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 455} {0: 1, 1: 0, 2: 0, 3: 19, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!