ID: 1106552099_1106552104

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1106552099 1106552104
Species Human (GRCh38) Human (GRCh38)
Location 13:30780940-30780962 13:30780966-30780988
Sequence CCCCACCAGATCTCATATTGAAA GATCTCCACTGTGGCTGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 185, 3: 1656, 4: 4145} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!