ID: 1106597151_1106597157

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1106597151 1106597157
Species Human (GRCh38) Human (GRCh38)
Location 13:31154822-31154844 13:31154868-31154890
Sequence CCAAAAATTAGCACACATTCCCT TTGTAGTTGTTTTGGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 295} {0: 1, 1: 0, 2: 2, 3: 45, 4: 584}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!