ID: 1106653835_1106653845

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1106653835 1106653845
Species Human (GRCh38) Human (GRCh38)
Location 13:31721053-31721075 13:31721094-31721116
Sequence CCTGGCACCTCCTCCTTTTTCTC CCTTCACCTTCCACCATGAGTGG
Strand - +
Off-target summary No data {0: 51, 1: 210, 2: 455, 3: 810, 4: 1460}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!