ID: 1106656456_1106656464

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1106656456 1106656464
Species Human (GRCh38) Human (GRCh38)
Location 13:31752216-31752238 13:31752243-31752265
Sequence CCCAAATCTGTCTTTCAAACATT AGTCATCTGAAGAAGGAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 66, 4: 725} {0: 1, 1: 0, 2: 0, 3: 28, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!