ID: 1106663468_1106663476

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1106663468 1106663476
Species Human (GRCh38) Human (GRCh38)
Location 13:31826824-31826846 13:31826846-31826868
Sequence CCCACCCCAAAACCCTTAAAAAC CCCTTGCCCTAAACTCCTCATGG
Strand - +
Off-target summary {0: 1, 1: 25, 2: 59, 3: 130, 4: 656} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!