ID: 1106690950_1106690955

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1106690950 1106690955
Species Human (GRCh38) Human (GRCh38)
Location 13:32115781-32115803 13:32115802-32115824
Sequence CCAGCCTCCTTCTCCCTCTAGTG TGATCTGACCTAAGAACCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 58, 4: 560} {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!