ID: 1106705597_1106705602

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1106705597 1106705602
Species Human (GRCh38) Human (GRCh38)
Location 13:32275742-32275764 13:32275779-32275801
Sequence CCCAGCTCAAACTGCAAATGATG TCAAAACAGTCTCTGGCTGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135} {0: 1, 1: 0, 2: 1, 3: 15, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!