ID: 1106717945_1106717948

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1106717945 1106717948
Species Human (GRCh38) Human (GRCh38)
Location 13:32410265-32410287 13:32410282-32410304
Sequence CCGCAGGGCCTGTCATCCTTCTG CTTCTGAAAGAGCCTCACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 306} {0: 1, 1: 0, 2: 1, 3: 14, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!