ID: 1106759471_1106759477

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1106759471 1106759477
Species Human (GRCh38) Human (GRCh38)
Location 13:32853907-32853929 13:32853955-32853977
Sequence CCATTCTGCAACTGCTGATATAG AATGGATGCTGAAACCACTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 260} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!