ID: 1106776671_1106776682

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1106776671 1106776682
Species Human (GRCh38) Human (GRCh38)
Location 13:33016324-33016346 13:33016343-33016365
Sequence CCAGCGGAGCCCGCCGGGGAGCG AGCGGGGGTGGGCGCGCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 161} {0: 1, 1: 0, 2: 3, 3: 39, 4: 425}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!