ID: 1106780757_1106780770

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1106780757 1106780770
Species Human (GRCh38) Human (GRCh38)
Location 13:33056971-33056993 13:33057018-33057040
Sequence CCCTCCTCAGAGTGGATTCCACT TGGGAGAAGTGAGGCTGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 176} {0: 1, 1: 1, 2: 0, 3: 59, 4: 696}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!