ID: 1106788776_1106788782

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1106788776 1106788782
Species Human (GRCh38) Human (GRCh38)
Location 13:33133200-33133222 13:33133226-33133248
Sequence CCTTTATTTAGGTTAAGAACACA CAAGCTGGGCACTGTGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 247} {0: 1, 1: 0, 2: 2, 3: 50, 4: 495}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!