ID: 1106792796_1106792797

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1106792796 1106792797
Species Human (GRCh38) Human (GRCh38)
Location 13:33172761-33172783 13:33172775-33172797
Sequence CCAAATTAAAATTTATTATTATC ATTATTATCAGACATGTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 118, 4: 1061} {0: 1, 1: 0, 2: 1, 3: 15, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!