ID: 1106794253_1106794257

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1106794253 1106794257
Species Human (GRCh38) Human (GRCh38)
Location 13:33188069-33188091 13:33188089-33188111
Sequence CCTGGTTGCTGGGCCATGGGAAA AAAGAGCACTGGCCAAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 202} {0: 1, 1: 0, 2: 2, 3: 24, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!