ID: 1106802523_1106802529

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1106802523 1106802529
Species Human (GRCh38) Human (GRCh38)
Location 13:33270949-33270971 13:33271001-33271023
Sequence CCTGCACACTCCCACAAGCAGAG CAGTCAAGAAGCCAGGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 291} {0: 1, 1: 0, 2: 0, 3: 44, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!