ID: 1106854333_1106854335

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1106854333 1106854335
Species Human (GRCh38) Human (GRCh38)
Location 13:33832142-33832164 13:33832159-33832181
Sequence CCAAATAAAAAATGACAATGTTA ATGTTAAGGCCCACTAACTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 714} {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!