ID: 1106925040_1106925041

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1106925040 1106925041
Species Human (GRCh38) Human (GRCh38)
Location 13:34605129-34605151 13:34605148-34605170
Sequence CCTTCACAGGGCTGCTTGACTGT CTGTGCTCACAGCAAGAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 27, 4: 164} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!