|
Left Crispr |
Right Crispr |
| Crispr ID |
1106965740 |
1106965744 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:35064635-35064657
|
13:35064662-35064684
|
| Sequence |
CCGTAATCTGACTGTTTTTGGAG |
GGTCTTTAAAGAGGTAATTAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 45, 3: 245, 4: 812} |
{0: 37, 1: 164, 2: 395, 3: 746, 4: 1265} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|