ID: 1106965740_1106965746

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1106965740 1106965746
Species Human (GRCh38) Human (GRCh38)
Location 13:35064635-35064657 13:35064680-35064702
Sequence CCGTAATCTGACTGTTTTTGGAG TAAGGTTAAGTGAGGTCATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 45, 3: 245, 4: 812} {0: 6, 1: 36, 2: 277, 3: 819, 4: 1699}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!