ID: 1106965740_1106965748

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1106965740 1106965748
Species Human (GRCh38) Human (GRCh38)
Location 13:35064635-35064657 13:35064688-35064710
Sequence CCGTAATCTGACTGTTTTTGGAG AGTGAGGTCATTTGGTTATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 45, 3: 245, 4: 812} {0: 1, 1: 0, 2: 1, 3: 11, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!