ID: 1106968051_1106968052

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1106968051 1106968052
Species Human (GRCh38) Human (GRCh38)
Location 13:35097189-35097211 13:35097228-35097250
Sequence CCTATTGAAACTGGAAGAGCTAG GAATAACTTCAGATTCCTTTTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 7, 4: 132} {0: 3, 1: 0, 2: 1, 3: 24, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!