ID: 1107003929_1107003938

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1107003929 1107003938
Species Human (GRCh38) Human (GRCh38)
Location 13:35585270-35585292 13:35585316-35585338
Sequence CCTCCCATTCAGTCTTTAGCCTG CACTTTACTGAACTGTTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 169} {0: 1, 1: 0, 2: 3, 3: 21, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!