ID: 1107023780_1107023787

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1107023780 1107023787
Species Human (GRCh38) Human (GRCh38)
Location 13:35778684-35778706 13:35778711-35778733
Sequence CCCATCCTGGGAACCATGTGAAG ACACTAAAGCCAACACAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 138} {0: 1, 1: 0, 2: 1, 3: 10, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!