ID: 1107064301_1107064306

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1107064301 1107064306
Species Human (GRCh38) Human (GRCh38)
Location 13:36195976-36195998 13:36195996-36196018
Sequence CCTACACTGGTGTAGGTGGTGTG GTGGTGACACAGAGGGAATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 149} {0: 1, 1: 0, 2: 3, 3: 31, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!