ID: 1107071427_1107071431

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1107071427 1107071431
Species Human (GRCh38) Human (GRCh38)
Location 13:36274041-36274063 13:36274069-36274091
Sequence CCCACTTCATTCTCCTTCTCTAT CTTCCTATGAGTTGTGTTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 70, 4: 805} {0: 1, 1: 0, 2: 0, 3: 15, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!