ID: 1107078072_1107078074

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1107078072 1107078074
Species Human (GRCh38) Human (GRCh38)
Location 13:36345633-36345655 13:36345650-36345672
Sequence CCAAGAGAAACTTTTCTCAGGCC CAGGCCCAGAATTAAGTCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 180} {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!