ID: 1107088952_1107088957

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1107088952 1107088957
Species Human (GRCh38) Human (GRCh38)
Location 13:36455247-36455269 13:36455281-36455303
Sequence CCAAACAGGAGGGAGGAACTAAA CAGAACAAGAAGAAAATGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 62, 4: 711}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!