ID: 1107120723_1107120727

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1107120723 1107120727
Species Human (GRCh38) Human (GRCh38)
Location 13:36792617-36792639 13:36792633-36792655
Sequence CCCATTTCAGAAATCACATCACT CATCACTATGGGCACCACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 338} {0: 1, 1: 0, 2: 1, 3: 14, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!