ID: 1107124413_1107124420

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1107124413 1107124420
Species Human (GRCh38) Human (GRCh38)
Location 13:36830972-36830994 13:36831009-36831031
Sequence CCTACTAGTAGTCCTCTGAGAGC TTCATAGTAGAATTTTGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66} {0: 1, 1: 0, 2: 0, 3: 21, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!