ID: 1107133454_1107133469

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1107133454 1107133469
Species Human (GRCh38) Human (GRCh38)
Location 13:36920118-36920140 13:36920157-36920179
Sequence CCTGGCTGCGCGCGCCCAGCGCC GGCGGCGGGGACCGAGACAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 341} {0: 1, 1: 0, 2: 3, 3: 29, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!