ID: 1107140446_1107140451

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1107140446 1107140451
Species Human (GRCh38) Human (GRCh38)
Location 13:36992988-36993010 13:36993012-36993034
Sequence CCACCAAAAAAGTGCTCCTCAGG GAAGATGCACAGCCTCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 128} {0: 1, 1: 0, 2: 2, 3: 24, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!