ID: 1107177495_1107177503

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1107177495 1107177503
Species Human (GRCh38) Human (GRCh38)
Location 13:37416084-37416106 13:37416118-37416140
Sequence CCTTTCCAGGAAGGCTTTTTGCT TTACTCTGAAGAATGGGGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 20, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!