ID: 1107187276_1107187277

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1107187276 1107187277
Species Human (GRCh38) Human (GRCh38)
Location 13:37538406-37538428 13:37538452-37538474
Sequence CCATTAAAACATTTTAGAGCTGA ATGAGCTTTTTAGATCACCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!