ID: 1107207377_1107207381

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1107207377 1107207381
Species Human (GRCh38) Human (GRCh38)
Location 13:37808933-37808955 13:37808970-37808992
Sequence CCTACATCATAGTGGTAAGACTC TTCAGTTTTTCTTTCAAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73} {0: 1, 1: 0, 2: 6, 3: 75, 4: 684}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!