|
Left Crispr |
Right Crispr |
| Crispr ID |
1107210062 |
1107210066 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:37842596-37842618
|
13:37842629-37842651
|
| Sequence |
CCAACTTTCTAGTTCATAGATGG |
CTGTGTTCCCACATGGTGAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 42, 2: 230, 3: 463, 4: 880} |
{0: 1, 1: 14, 2: 108, 3: 566, 4: 1336} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|