ID: 1107241732_1107241737

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1107241732 1107241737
Species Human (GRCh38) Human (GRCh38)
Location 13:38243471-38243493 13:38243486-38243508
Sequence CCCACATCTGTAACCCCAGGAGT CCAGGAGTCTGAGATCAGCTTGG
Strand - +
Off-target summary No data {0: 9, 1: 189, 2: 3749, 3: 31929, 4: 101483}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!