ID: 1107242107_1107242114

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1107242107 1107242114
Species Human (GRCh38) Human (GRCh38)
Location 13:38248690-38248712 13:38248733-38248755
Sequence CCTTTCTCCTCCTCCTTCTTCTG GAACATCCCGTGTCCAGTAGAGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 138, 3: 777, 4: 3677} {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!