ID: 1107348876_1107348880

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1107348876 1107348880
Species Human (GRCh38) Human (GRCh38)
Location 13:39493037-39493059 13:39493056-39493078
Sequence CCCTAATTTCTATAACCATACTC ACTCCTGCTGTTGGTCATTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 280} {0: 1, 1: 0, 2: 2, 3: 16, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!