ID: 1107389706_1107389724

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1107389706 1107389724
Species Human (GRCh38) Human (GRCh38)
Location 13:39951427-39951449 13:39951466-39951488
Sequence CCACAGATGTTACACAGGATCAG AGGGCAGGGGGTGGATGGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 13, 3: 285, 4: 2378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!