ID: 1107389706_1107389728

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1107389706 1107389728
Species Human (GRCh38) Human (GRCh38)
Location 13:39951427-39951449 13:39951472-39951494
Sequence CCACAGATGTTACACAGGATCAG GGGGGTGGATGGGGAGGGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 79, 3: 1399, 4: 10552}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!