ID: 1107456392_1107456407

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1107456392 1107456407
Species Human (GRCh38) Human (GRCh38)
Location 13:40559728-40559750 13:40559769-40559791
Sequence CCATAGCCATTGCAGCTGCTCAC GGCACTCATCTGCATGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 160} {0: 2, 1: 0, 2: 1, 3: 10, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!