ID: 1107456530_1107456533

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1107456530 1107456533
Species Human (GRCh38) Human (GRCh38)
Location 13:40560592-40560614 13:40560608-40560630
Sequence CCAGGGCTTGCAGGCCATTTGGA ATTTGGAAAACTGTGATCCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 191} {0: 1, 1: 0, 2: 2, 3: 28, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!