ID: 1107475773_1107475776

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1107475773 1107475776
Species Human (GRCh38) Human (GRCh38)
Location 13:40734327-40734349 13:40734355-40734377
Sequence CCCAGGAGGAGGGCAAAATGATA ACAGTTGTGCCAGAAGACCTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 19, 4: 202} {0: 1, 1: 0, 2: 1, 3: 14, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!