ID: 1107479163_1107479173

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1107479163 1107479173
Species Human (GRCh38) Human (GRCh38)
Location 13:40771204-40771226 13:40771235-40771257
Sequence CCCTCTCTTCCGCTTCCGGCCTG CTCCCCCTTTGCGCTCCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 251} {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!